Sequence ID | >WENV170016161 |
Genome ID | AZIJ01013636 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 166 |
End posion on genome | 251 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
cgcgccgcag |
tRNA gene sequence |
GCCCGCGTGGTGGAATGGTAGACACAGGGGACTTAAAATCCCCAGGCCGAAAGGCCGTGC |
Downstream region at tRNA end position |
atttgatcga |
Secondary structure (Cloverleaf model) | >WENV170016161 Leu TAA g ACCA atttgatcga G + T C - G C - G C - G G - C C - G G - C T G T C G G C C A T A A G | | | | | G G G G T G G C C G G C G | | | T T T A C A C A G A AGGCCGAAAGGCCGT G - C G - C G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |