Sequence ID | >WENV170016162 |
Genome ID | AZIJ01013652 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 232 |
End posion on genome | 146 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
cgtttctcgt |
tRNA gene sequence |
GCCCAGGTGGCGGAATTGGTAGACGCACTAGGTTCAGGTCCTAGCGGTGGCAACACCGTG |
Downstream region at tRNA end position |
tcatcttgag |
Secondary structure (Cloverleaf model) | >WENV170016162 Leu CAG t ACCA tcatcttgag G - C C - G C - G C - G A - T G - C G - C T G T T C T T C A T A A G + | | | | G T G G C G G G A A G C G | | | T T G A C G C T A G A CGGTGGCAACACCGT C - G T - A A - T G - C G - C T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |