Sequence ID | >WENV170016164 |
Genome ID | AZIJ01013754 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 2899 |
End posion on genome | 2982 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
ataagtatcc |
tRNA gene sequence |
ACCCGGGTGCTGGAATTGGTAGACAGGCATGGTTGAGGGCCATGTGTCCTTTGGGCGTGT |
Downstream region at tRNA end position |
tttttcccaa |
Secondary structure (Cloverleaf model) | >WENV170016164 Leu GAG c ACat tttttcccaa A - T C - G C - G C - G G - C G - C G - C T G T T A C C C A T A A G + | | | | A T G G T C G T G G G C G | | | T T G A C A G T A G G TGTCCTTTGGGCGT C - G A - T T - A G - C G - C T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |