Sequence ID | >WENV170016165 |
Genome ID | AZIJ01013903 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 51291 |
End posion on genome | 51367 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
ttttgtttgc |
tRNA gene sequence |
GCCTTTATAGCTCAACTGGATAGAGCAATGGTCTACGAAATCATAGGTTGCAGGTTCGAG |
Downstream region at tRNA end position |
gtttgatagt |
Secondary structure (Cloverleaf model) | >WENV170016165 Arg ACG c ACCA gtttgatagt G - C C - G C - G T - A T - A T - A A - T T G T C G T C C A C A A A | | | | | G T C T C G G C A G G C G | | | | T T G G A G C A T A A AGGTT A - T T - A G - C G + T T - A C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |