Sequence ID | >WENV170016166 |
Genome ID | AZIJ01013903 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 51387 |
End posion on genome | 51462 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
taagagttct |
tRNA gene sequence |
ACCCCATTCGTCTAGCGGTCTAGGACAGCGGGTTTTCAATCCGTTAACACCGGTTCGAGT |
Downstream region at tRNA end position |
gttttttgct |
Secondary structure (Cloverleaf model) | >WENV170016166 Glu TTC t ACCA gttttttgct A - T C - G C - G C - G C - G A - T T - A T G T T G G C C A C G A C | | | | | G G T C T G A C C G G C G + | | | T T T G G A C C T A A TAAC G + T C - G G - C G - C G + T T A T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |