Sequence ID | >WENV170016170 |
Genome ID | AZIJ01013903 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 51748 |
End posion on genome | 51822 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
tataggtttc |
tRNA gene sequence |
GCCCCATTCGTCTAGCGGTCAGGATTTCGGACTCTCTATCCGACGACGCCGGTTCGAATC |
Downstream region at tRNA end position |
tttttggttc |
Secondary structure (Cloverleaf model) | >WENV170016170 Glu CTC c ACCA tttttggttc G - C C - G C - G C - G C - G A - T T - A T A T C G G C C A C G A C | | | | | G G T C T G G C C G G C G + | | + T T T G G A T C A T CGAC T - A C - G G - C G - C A - T C A T T C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |