Sequence ID | >WENV170016171 |
Genome ID | AZIJ01013903 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 51828 |
End posion on genome | 51903 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
caccattttt |
tRNA gene sequence |
GGTTCATTCGTCTAGGGGTCTAGGACACGGCACTGTCACTGCCGAAACACGGGTTCGATT |
Downstream region at tRNA end position |
gtttaaatag |
Secondary structure (Cloverleaf model) | >WENV170016171 Asp GTC t GCCA gtttaaatag G - C G - C T - A T - A C - G A - T T - A T T T T G C C C A G G A C | | | | | G G T C T G A C G G G C G + | | | T T T G G A C C T A A AAAC C - G G - C G - C C - G A - T C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |