Sequence ID | >WENV170016172 |
Genome ID | AZIJ01013903 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 51914 |
End posion on genome | 51990 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
gtttaaatag |
tRNA gene sequence |
GCTTTCGTAGCTCAGTTGGATAGAGCGCCACCCTCCGAAGGTGGAGGCCCCAGGTTCGAC |
Downstream region at tRNA end position |
tcattgagcc |
Secondary structure (Cloverleaf model) | >WENV170016172 Arg CCG g ACCA tcattgagcc G - C C - G T - A T - A T - A C - G G - C T C T G G T C C A T G A A | | | | | G T C T C G C C A G G C G | | | | T T G G A G C A T A G AGGCC C - G C - G A - T C - G C - G C A T A C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |