Sequence ID | >WENV170016174 |
Genome ID | AZIJ01014087 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 563 |
End posion on genome | 648 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
cttggcccgt |
tRNA gene sequence |
GCCCAAGTGGCGGAATGGTAGACGCAGGGGATTCAAAATCCCCCGATGGCAACATCGTGA |
Downstream region at tRNA end position |
gatcatccga |
Secondary structure (Cloverleaf model) | >WENV170016174 Leu CAA t ACCA gatcatccga G - C C - G C - G C - G A - T A - T G - C T A T C T C T C A T A A G | | | | | G G G G C G G A G A G C G | | | T T T A C G C A G A CGATGGCAACATCGT G - C G - C G - C G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |