Sequence ID | >WENV170016177 |
Genome ID | AZIJ01014587 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 2326 |
End posion on genome | 2402 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
aacaagcagt |
tRNA gene sequence |
GGCTATGTAGCTCAGTTGGTTAGAGCACATCACTCATAATGATGGGGTCGCAGGTTCGAA |
Downstream region at tRNA end position |
ttgctggggt |
Secondary structure (Cloverleaf model) | >WENV170016177 Met CAT t ACCA ttgctggggt G - C G - C C - G T - A A - T T - A G - C T A T C G C C C A T G A A | | | | G T C T C G G C A G G C G | | | | T T G G A G C T T A A GGGTC C - G A - T T - A C - G A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |