Sequence ID | >WENV170016181 |
Genome ID | AZIJ01014755 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 9429 |
End posion on genome | 9337 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
acggggagct |
tRNA gene sequence |
GGAGAGGTGGCCGAGTGGCTGAAGGCGGCGGTTTGCTAAACCGTTGTACAGTGTAAAGCT |
Downstream region at tRNA end position |
tattttcaat |
Secondary structure (Cloverleaf model) | >WENV170016181 Ser GCT t GCCA tattttcaat G - C G - C A - T G - C A - T G - C G - C T A T T A C C C A T G A G + | | | | G G G C C G G T G G G C G | | | T T C A G G C T G A G TGTACAGTGTAAAGCTGTACC G + T C - G G - C G - C T - A T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |