Sequence ID | >WENV170016182 |
Genome ID | AZIJ01014957 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 1962 |
End posion on genome | 1886 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
cggggactgg |
tRNA gene sequence |
GGGCCTGTAGCTCAGTTGGTTAGAGCGGACCGCTCATAACGGTTTGGTCGCAGGTTCGAG |
Downstream region at tRNA end position |
gctttcgtcc |
Secondary structure (Cloverleaf model) | >WENV170016182 Met CAT g ACCA gctttcgtcc G - C G - C G - C C - G C - G T + G G - C T G T C G T C C A T G A A | | | | | G T C T C G G C A G G C G | | | | T T G G A G C T T A G TGGTC G + T A - T C - G C - G G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |