Sequence ID | >WENV170016185 |
Genome ID | AZIJ01015039 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 626 |
End posion on genome | 702 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
aatacaatgt |
tRNA gene sequence |
GCGTCCGTAGCTCAGTTGGTTAGAGCACTACCTTGACATGGTAGGGGTCGGTAGTTCGAG |
Downstream region at tRNA end position |
tcttcttcac |
Secondary structure (Cloverleaf model) | >WENV170016185 Val GAC t ACCA tcttcttcac G - C C - G G - C T - A C - G C - G G - C T G T T C A T C A T G A A + | | | | G T C T C G G G T A G C G | | | | T T G G A G C T T A A GGGTC C - G T - A A - T C - G C - G T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |