Sequence ID | >WENV170016192 |
Genome ID | AZIJ01015410 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 379 |
End posion on genome | 303 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
gtataatagt |
tRNA gene sequence |
CGGGGCGTAGCTCAGCCTGGTAGAGCGATCGCTTTGGGTGCGATAGGTCGTGAGTTCGAA |
Downstream region at tRNA end position |
tttcatcaac |
Secondary structure (Cloverleaf model) | >WENV170016192 Pro TGG t ACCA tttcatcaac C - G G - C G - C G - C G - C C - G G - C T A T C G C T C A C G A A | + | | | G C C T C G G T G A G C T | | | | T T G G A G C G T A G AGGTC A - T T - A C - G G - C C - G T T T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |