Sequence ID | >WENV170016193 |
Genome ID | AZIJ01015467 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 1034 |
End posion on genome | 958 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
gctctttttg |
tRNA gene sequence |
GGGCCTTTAGCTCAGTTGGTTAGAGCATCCGACTCATAATCGGCAGGTCCTGGGTTCAAG |
Downstream region at tRNA end position |
ctttctgaaa |
Secondary structure (Cloverleaf model) | >WENV170016193 Met CAT g ACCA ctttctgaaa G - C G - C G - C C - G C - G T - A T - A T G T G G C C C A T G A A | + | | | A T C T C G C T G G G C G | | | | T T G G A G C T T A A AGGTC T C C - G C - G G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |