Sequence ID | >WENV170016196 |
Genome ID | AZIJ01015708 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 1661 |
End posion on genome | 1585 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
aaacgcgcgt |
tRNA gene sequence |
CGGGGCGTGGCGCAGTCTGGTAGCGCACCTGTTTTGGGTACAGGGGGTCGTGAGTTCGAA |
Downstream region at tRNA end position |
cttcttccac |
Secondary structure (Cloverleaf model) | >WENV170016196 Pro TGG t ACCA cttcttccac C - G G - C G - C G - C G - C C - G G - C T A T C G C T C A T G A G | + | | | G C C G C G G T G A G C T | | | | T T G G C G C G T A A GGGTC C - G C - G T - A G - C T - A T T T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |