Sequence ID | >WENV170016197 |
Genome ID | AZIJ01015752 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 2163 |
End posion on genome | 2087 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
agaggcgcac |
tRNA gene sequence |
GCACCCGTAGCTCAGCTGGATAGAGCGCTGCCCTCCGAAGGCAGAGGTCATAGGTTCGAA |
Downstream region at tRNA end position |
tttcctttcg |
Secondary structure (Cloverleaf model) | >WENV170016197 Arg CCG c GCCA tttcctttcg G - C C - G A - T C - G C - G C - G G - C T A T T A T C C A C G A A | | | | | G T C T C G A T A G G C G | | | | T T G G A G C A T A G AGGTC C - G T - A G - C C - G C - G C A T A C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |