Sequence ID | >WENV170016199 |
Genome ID | AZIJ01015852 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 3543 |
End posion on genome | 3468 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
gttacgcaac |
tRNA gene sequence |
AGGCCAGTAGCTCAACTGGCAGAGCAGCGGTCTCCAAAACCGCAGGTTGGGGGTTCGAGT |
Downstream region at tRNA end position |
ttcctaatcg |
Secondary structure (Cloverleaf model) | >WENV170016199 Trp CCA c GCCA ttcctaatcg A - T G - C G - C C - G C - G A - T G - C T G T C T C C C A C A A A | + | | | G T C T C G G G G G G C G | | | | T T G G A G C C A A AGGTT G - C C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |