Sequence ID | >WENV170016201 |
Genome ID | AZIJ01016097 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 293 |
End posion on genome | 218 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
attatggaat |
tRNA gene sequence |
TGGCCCATGGTGTAACTGGCAACACGTCTGGTTTTGGTCCAGAAGAGTCTAGGTTCGAGC |
Downstream region at tRNA end position |
aagtctcagt |
Secondary structure (Cloverleaf model) | >WENV170016201 Gln TTG t ACAA aagtctcagt T - A G - C G - C C - G C - G C - G A - T C G T G A T C C A C A A G | | | | | G T T G T G C T A G G C G | | | | T T G A C A C C A G AGAGT T - A C - G T - A G - C G - C T T T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |