Sequence ID | >WENV170016202 |
Genome ID | AZIJ01016102 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 243 |
End posion on genome | 159 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
gcgcgccaat |
tRNA gene sequence |
GCGGGTGTGGCGAAATTGGTAGACGCACCAGATTTAGGTTCTGGCGCCGCAAGGCGTGGG |
Downstream region at tRNA end position |
atccccaccg |
Secondary structure (Cloverleaf model) | >WENV170016202 Leu TAG t ACCA atccccaccg G - C C - G G - C G - C G - C T - A G - C T G T C T C C C A T A A G | + | | | A T A G C G G G G G G C G | | | T T G A C G C T A G A CGCCGCAAGGCGT C - G C - G A - T G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |