Sequence ID | >WENV170016203 |
Genome ID | AZIJ01016343 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 8801 |
End posion on genome | 8890 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
cgtcctctgc |
tRNA gene sequence |
GGAGAGGTGGCTGAGTGGTTGAAAGTACCGCACTCGAAATGCGGCGTACTCGCAAGGGTA |
Downstream region at tRNA end position |
ttaaaaacgg |
Secondary structure (Cloverleaf model) | >WENV170016203 Ser CGA c GCCA ttaaaaacgg G - C G - C A - T G - C A - T G - C G - C T A T C A C C C A T G A G | | | | | G G G T C G G T G G G C G | | + T T T A A G T T G A A CGTACTCGCAAGGGTACC C - G C - G G - C C - G A - T C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |