Sequence ID | >WENV170016204 |
Genome ID | AZIJ01016384 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 2788 |
End posion on genome | 2712 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
gaagcgaact |
tRNA gene sequence |
CGGGGCGTAGCGCAGTCTGGTAGCGCACCTGTATGGGGTGCAGGTGGTCGCAGGTTCAAA |
Downstream region at tRNA end position |
tattcccgaa |
Secondary structure (Cloverleaf model) | >WENV170016204 Pro GGG t ACCA tattcccgaa C - G G - C G - C G - C G + T C - G G - C T A T C G T C C A T G A A | | | | | A C C G C G G C A G G C T | | | | T T G G C G C G T A A TGGTC C - G C - G T - A G - C T + G A T T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |