Sequence ID | >WENV170016205 |
Genome ID | AZIJ01016417 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 1399 |
End posion on genome | 1315 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
gtctaccggt |
tRNA gene sequence |
GGCAGTGTGATGGAATTGGTAGACATGAGTGATTCAAAATCACTTGCCTTCGGGCGTGCC |
Downstream region at tRNA end position |
acaaaaaccc |
Secondary structure (Cloverleaf model) | >WENV170016205 Leu CAA t ACCA acaaaaaccc G + T G - C C - G A - T G - C T - A G - C T G T C G G C C A T A A G | | | | | G T G G T A G C C G G C G | | | T T G A C A T T A G G TGCCTTCGGGCGT A - T G - C T - A G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |