Sequence ID | >WENV170016208 |
Genome ID | AZIJ01016514 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 1258 |
End posion on genome | 1182 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
tgcaggacac |
tRNA gene sequence |
AGGACCATAGCTCAGTTGGTTAGAGCGCTACCTTGACATGGTAGAGGTCCCCGGTTCGAA |
Downstream region at tRNA end position |
ttcctgcgaa |
Secondary structure (Cloverleaf model) | >WENV170016208 Val GAC c ACCA ttcctgcgaa A - T G - C G - C A - T C - G C - G A - T T A T G G G C C A T G A A | | | | | G T C T C G C C C G G C G | | | | T T G G A G C T T A G AGGTC C - G T - A A - T C - G C - G T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |