Sequence ID | >WENV170016215 |
Genome ID | AZIJ01017211 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 8579 |
End posion on genome | 8654 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
ctttgtgtgc |
tRNA gene sequence |
GGGCGGTTAGCTCAGTTGGTAGAGCATCTCGTTTACACCGAGAGGGTCGGCGGTTCGAGC |
Downstream region at tRNA end position |
gtccttgtct |
Secondary structure (Cloverleaf model) | >WENV170016215 Val TAC c ACCA gtccttgtct G - C G - C G - C C - G G - C G - C T - A C G T C T G C C A T G A A | + | | | G T C T C G G G C G G C G | | | | T T G G A G C T A A GGGTC T - A C - G T - A C - G G - C T C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |