Sequence ID | >WENV170016216 |
Genome ID | AZIJ01017211 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 8794 |
End posion on genome | 8870 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
ccgtcggcaa |
tRNA gene sequence |
GGGGGTGTAGCTCAGTTGGTTAGAGCGCCGGCCTGTCACGCCGGAGGCCGCGGGTTCGAG |
Downstream region at tRNA end position |
ttttctccag |
Secondary structure (Cloverleaf model) | >WENV170016216 Asp GTC a GCCA ttttctccag G - C G - C G - C G + T G - C T - A G - C T G T T G C C C A T G A A + | | | | G T C T C G G C G G G C G | | | | T T G G A G C T T A G AGGCC C - G C - G G - C G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |