Sequence ID | >WENV170016218 |
Genome ID | AZIJ01017345 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 10064 |
End posion on genome | 9980 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
tggctgatgt |
tRNA gene sequence |
GCGAAAGTGGCGGAATTGGTAGACGCGCTGGATTTAGGTTCCAGTGGGGTAACCCGTGAG |
Downstream region at tRNA end position |
cctttccctt |
Secondary structure (Cloverleaf model) | >WENV170016218 Leu TAG t ACCA cctttccctt G - C C - G G - C A - T A - T A - T G - C T G T C T C T C A T A A G | | | | | G T G G C G G A G A G C G | | | T T G A C G C T A G G TGGGGTAACCCGT C - G T - A G - C G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |