Sequence ID | >WENV170016220 |
Genome ID | AZIJ01017366 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 572 |
End posion on genome | 497 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
tggcacgcat |
tRNA gene sequence |
GCGCTCATAGCTCAACTGGATAGAGTACAGGTCTCCGAAGCCTGTGGCGTGGGTTCGAGT |
Downstream region at tRNA end position |
tcgtcttatt |
Secondary structure (Cloverleaf model) | >WENV170016220 Arg CCG t ACCA tcgtcttatt G - C C - G G - C C - G T - A C - G A - T T G T C G C C C A C A A A | + | | | G T C T C G G T G G G C G | | | + T T G G A G T A T A A TGGC C - G A - T G - C G - C T + G C A T A C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |