Sequence ID | >WENV170016222 |
Genome ID | AZIJ01017483 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 6135 |
End posion on genome | 6060 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
cgccatttct |
tRNA gene sequence |
TGGCATGTAGCTCAGATGGTAGAGCAGGTGACTGTTAATCACCGGGTCGGGGGTTCGAGC |
Downstream region at tRNA end position |
agcggacgta |
Secondary structure (Cloverleaf model) | >WENV170016222 Asn GTT t GCCA agcggacgta T - A G - C G - C C - G A - T T + G G - C C G T C T C C C A A G A A | + | | | G T C T C G G G G G G C G | | | | T T G G A G C T A A GGGTC G - C G - C T - A G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |