Sequence ID | >WENV170016223 |
Genome ID | AZIJ01017483 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 6058 |
End posion on genome | 5983 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
tgccagccaa |
tRNA gene sequence |
GCGGACGTAGCTCAGTTGGTAGAGCATCTGCCTTCCAAGCAGATGGTCGCGAGTTCGAAT |
Downstream region at tRNA end position |
tttttaaaat |
Secondary structure (Cloverleaf model) | >WENV170016223 Gly TCC a TCCA tttttaaaat G - C C - G G - C G - C A - T C - G G - C T A T T G C T C A T G A A + | | | | G T C T C G G C G A G C G | | | | T T G G A G C T A A TGGTC T - A C - G T - A G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |