Sequence ID | >WENV170016224 |
Genome ID | AZIJ01017497 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 4466 |
End posion on genome | 4390 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
aaatttatta |
tRNA gene sequence |
GGGCCTATAGCTCAGTTGGTTAGAGCAGCGGACTCATAATCCGTTGGTCCCGTGTTCAAG |
Downstream region at tRNA end position |
tataaaacaa |
Secondary structure (Cloverleaf model) | >WENV170016224 Met CAT a ACCA tataaaacaa G - C G - C G - C C - G C - G T + G A - T T G T G G C A C A T G A A | | | | | A T C T C G C C G T G C G | | | | T T G G A G C T T A A TGGTC G + T C - G G - C G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |