Sequence ID | >WENV170016225 |
Genome ID | AZIJ01017508 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 15470 |
End posion on genome | 15395 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
acctcaagaa |
tRNA gene sequence |
GTCCCTATCGTCTAGAGGCCTAGGACATCGCCCTTTCACGGCGGTAACCGGGGTTCGAAT |
Downstream region at tRNA end position |
aattcaaaaa |
Secondary structure (Cloverleaf model) | >WENV170016225 Glu TTC a GCCA aattcaaaaa G - C T - A C - G C - G C - G T - A A - T T A T G C C C C A A G A C | | | | | G G T C T G C G G G G C G + | | | T T C G G A C C T A A TAAC T + G C - G G - C C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |