Sequence ID | >WENV170016229 |
Genome ID | AZIJ01017570 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 1911 |
End posion on genome | 1836 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
cacacaaact |
tRNA gene sequence |
GGGGCCATAGCTCAGTTGGTAGAGCGCTACAATGGCATTGTAGAGGTCAGCAGTTCGATC |
Downstream region at tRNA end position |
gacattttgt |
Secondary structure (Cloverleaf model) | >WENV170016229 Ala GGC t ACCA gacattttgt G - C G - C G + T G - C C - G C - G A - T C T T T C G T C A T G A A | | | | | G T C T C G A G C A G C G | | | | T T G G A G C T A G AGGTC C - G T - A A - T C - G A - T A T T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |