Sequence ID | >WENV170016231 |
Genome ID | AZIJ01017620 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 270 |
End posion on genome | 346 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
cagaacctgc |
tRNA gene sequence |
AGGGGTGTAGTTCCAATTGGTAGAACAGCGGTCTCCAAAACCGACGGTTGGGGGTTCGAA |
Downstream region at tRNA end position |
cattcagcta |
Secondary structure (Cloverleaf model) | >WENV170016231 Trp CCA c GCCA cattcagcta A - T G - C G - C G - C G - C T - A G - C T A T C T C C C A A A C A | + | | | G T C T T G G G G G G C T | | | | T T G G A A C G T A A CGGTT G A C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |