Sequence ID | >WENV170016237 |
Genome ID | AZIJ01017841 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 661 |
End posion on genome | 736 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
ccagattccc |
tRNA gene sequence |
GGACGCTTAGCTCAGCCGGGAGAGCACCTCCCTTACAAGGAGGGGGTCACTGGTTCGATC |
Downstream region at tRNA end position |
gttttcgtac |
Secondary structure (Cloverleaf model) | >WENV170016237 Val TAC c ACCA gttttcgtac G - C G - C A - T C - G G - C C - G T - A C T T T G A C C A C G A A | | | | | G C C T C G A C T G G C G | | | | T T G G A G C G A A GGGTC C - G C - G T - A C - G C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |