Sequence ID | >WENV170016244 |
Genome ID | AZIJ01018094 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 606 |
End posion on genome | 682 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
ccgcccacaa |
tRNA gene sequence |
CGGAGCGTAGCGCAGCCTGGTAGCGCGTCTCGTTCGGGACGAGAAGGTCGCTGGTTCGAT |
Downstream region at tRNA end position |
acagcaaaac |
Secondary structure (Cloverleaf model) | >WENV170016244 Pro CGG a ACCA acagcaaaac C - G G - C G - C A - T G - C C - G G - C T T T T G A C C A C G A A + | | | | G C C G C G G C T G G C T | | | | T T G G C G C G T A G AGGTC T - A C - G T - A C - G G - C T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |