Sequence ID | >WENV170016252 |
Genome ID | AZIJ01018414 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 12453 |
End posion on genome | 12528 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
aggtttttaa |
tRNA gene sequence |
GCGGGAATAGCTCAGTTGGTAGAGCACGACCTTGCCAAGGTCGGGGTCGCGAGTTCGAGT |
Downstream region at tRNA end position |
gtttttgttg |
Secondary structure (Cloverleaf model) | >WENV170016252 Gly GCC a TCCA gtttttgttg G - C C - G G - C G - C G - C A - T A - T T G T T G C T C A T G A A + | | | | G T C T C G G C G A G C G | | | | T T G G A G C T A A GGGTC C - G G - C A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |