Sequence ID | >WENV170016256 |
Genome ID | AZIJ01018477 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 515 |
End posion on genome | 588 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
agtctgcaaa |
tRNA gene sequence |
GGCGCGTTAGCAAAGCGGTTATGCAGCGGATTGCAAATCCGTTTAGTCCGGTTCGACTCC |
Downstream region at tRNA end position |
tattgtcact |
Secondary structure (Cloverleaf model) | >WENV170016256 Cys GCA a TCCA tattgtcact G - C G - C C - G G - C C - G G - C T - A T C T A G G C C A G A A | | | | | G C A A C G T C C G G C G | | | T T G A T G C T T A TTAG G + T C - G G - C G - C A - T T A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |