Sequence ID | >WENV170016260 |
Genome ID | AZIJ01018651 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 432 |
End posion on genome | 508 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
ggcgccaagc |
tRNA gene sequence |
GGTCCCTTAGCTCAACTGGATAGAGCAGCTGACTTCTAATCAGCAGGTTGAGGGTTCGAG |
Downstream region at tRNA end position |
tttcagatca |
Secondary structure (Cloverleaf model) | >WENV170016260 Arg TCT c GCCA tttcagatca G - C G + T T - A C - G C - G C - G T - A T G T C T T C C A C A A A | | + | | G T C T C G G A G G G C G | | | | T T G G A G C A T A A AGGTT G - C C - G T - A G - C A - T C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |