Sequence ID | >WENV170016262 |
Genome ID | AZIJ01018679 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 632 |
End posion on genome | 557 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
ctaagaaaga |
tRNA gene sequence |
GCCGGCATAGCTCAGTTGGTAGAGCAACTGACTTGTAATCAGTAGGTCCACAGTTCGAAT |
Downstream region at tRNA end position |
tcttaaagtg |
Secondary structure (Cloverleaf model) | >WENV170016262 Thr TGT a ACCA tcttaaagtg G - C C - G C - G G - C G - C C - G A - T T A T G T G C C A T G A A | | | | G T C T C G C A C A G C G | | | | T T G G A G C T A A AGGTC A - T C - G T - A G - C A - T C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |