Sequence ID | >WENV170016264 |
Genome ID | AZIJ01018679 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 383 |
End posion on genome | 308 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
ccaatgtcgt |
tRNA gene sequence |
GCGGGAGTAACTCAGTTGGTAGAGTGGCAGCCTTCCAAGCTGCATGTCGCGAGTTCGATC |
Downstream region at tRNA end position |
tcgaaggata |
Secondary structure (Cloverleaf model) | >WENV170016264 Gly TCC t TCCA tcgaaggata G - C C - G G - C G - C G - C A - T G - C C T T T G C T C A T G A A + | | | | G T C T C A G C G A G C G | | | | T T G G A G T T A G ATGTC G - C C - G A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |