Sequence ID | >WENV170016266 |
Genome ID | AZIJ01018744 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 5297 |
End posion on genome | 5371 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
caaggtacgt |
tRNA gene sequence |
GCGCCCTTCGTCTATCGGTTAGGACGCCAGATTTTCATTCTGGAAAGAGGGGTTCGACTC |
Downstream region at tRNA end position |
cattttttcg |
Secondary structure (Cloverleaf model) | >WENV170016266 Glu TTC t ACCA cattttttcg G + T C - G G - C C - G C - G C - G T - A T C T T C C C C A C T A C | | | | | G G T C T G A G G G G C G + | | | T T T G G A C T A G AAAG C - G C - G A - T G - C A - T T T T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |