Sequence ID | >WENV170016274 |
Genome ID | AZIJ01019066 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 12783 |
End posion on genome | 12859 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
tcggcaatgt |
tRNA gene sequence |
CGGGGCGTAGCGCAGCCTGGTAGCGCATCTGGTTTGGGACCAGAGGGTCGGGAGTTCGAA |
Downstream region at tRNA end position |
ttgaatttca |
Secondary structure (Cloverleaf model) | >WENV170016274 Pro TGG t ACCA ttgaatttca C - G G - C G - C G - C G - C C - G G - C T A T C T C T C A C G A A | + | | | G C C G C G G G G A G C T | | | | T T G G C G C G T A A GGGTC T - A C - G T - A G - C G - C T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |