Sequence ID | >WENV170016276 |
Genome ID | AZIJ01019120 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 15462 |
End posion on genome | 15537 |
Amino Acid | Ala |
Anticodon | CGC |
Upstream region at tRNA start position |
gtcgggttcc |
tRNA gene sequence |
GGGGCCGTAGCTCAGTTGGGAGAGCGCCTCGTTCGCAATGAGGAGGTCAGCGGTTCGATC |
Downstream region at tRNA end position |
ttcccggaag |
Secondary structure (Cloverleaf model) | >WENV170016276 Ala CGC c ACCA ttcccggaag G - C G - C G + T G - C C - G C - G G - C C T T T C G C C A T G A A | | | | | G T C T C G A G C G G C G | | | | T T G G A G C G A G AGGTC C - G C - G T - A C - G G + T T A T A C G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |