Sequence ID | >WENV170016279 |
Genome ID | AZIJ01019155 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 14003 |
End posion on genome | 13917 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
ttaaagtttt |
tRNA gene sequence |
GCCGAGGTGGTGGAATTGGTAGACACGCTATCTTGAGGGGGTAGTGCCCGTATGGGCGTG |
Downstream region at tRNA end position |
atttatagac |
Secondary structure (Cloverleaf model) | >WENV170016279 Leu GAG t ACCA atttatagac G - C C - G C - G G - C A - T G - C G + T T G T C G C C C A T A A G | | | | | A T G G T G G C G G G C G | | | T T G A C A C T A G G TGCCCGTATGGGCGT C - G T - A A - T T + G C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |