Sequence ID | >WENV170016285 |
Genome ID | AZIJ01019191 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 12250 |
End posion on genome | 12326 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
cggcccgcag |
tRNA gene sequence |
GCACCCGTAGCTCAGCTGGATAGAGCGCTGCCCTCCGAAGGCAGAGGTCGCACGTTCGAA |
Downstream region at tRNA end position |
ttccttagga |
Secondary structure (Cloverleaf model) | >WENV170016285 Arg CCG g GCCA ttccttagga G - C C - G A - T C - G C - G C - G G - C T A T C G T G C A C G A A | | | | | G T C T C G G C A C G C G | | | | T T G G A G C A T A G AGGTC C - G T - A G - C C - G C - G C A T A C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |