Sequence ID | >WENV170016289 |
Genome ID | AZIJ01019234 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 3846 |
End posion on genome | 3770 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
ctcgtgttgc |
tRNA gene sequence |
AGGGGCATAGTTCCAATTGGTAGAACAGCGGTCTCCAAAACCGACGGTTGGGGGTTCGAA |
Downstream region at tRNA end position |
gcttcaccga |
Secondary structure (Cloverleaf model) | >WENV170016289 Trp CCA c GCCA gcttcaccga A - T G - C G - C G - C G - C C - G A - T T A T C T C C C A A A C A | + | | | G T C T T G G G G G G C T | | | | T T G G A A C G T A A CGGTT G A C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |