Sequence ID | >WENV170016290 |
Genome ID | AZIJ01019267 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 22250 |
End posion on genome | 22174 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
gcctttctga |
tRNA gene sequence |
GACCCCGTAGCTCAGCTGGATAGAGCATCAGATTCCTAATCTGAGGGTCGCGCGTTCGAA |
Downstream region at tRNA end position |
ccttcctctg |
Secondary structure (Cloverleaf model) | >WENV170016290 Arg CCT a ACCA ccttcctctg G - C A - T C - G C - G C - G C - G G - C T A T C G C G C A C G A A | | | | | G T C T C G G C G C G C G | | | | T T G G A G C A T A A GGGTC T - A C - G A - T G - C A - T T A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |