Sequence ID | >WENV170016296 |
Genome ID | AZIJ01019916 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 137 |
End posion on genome | 48 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
ccgtcgatcc |
tRNA gene sequence |
GGTGAGGTGTCCGAGCGGTTGAAGGAGCACGCCTGGAAAGTGTGTATACGAGAAATCGTA |
Downstream region at tRNA end position |
gattagattc |
Secondary structure (Cloverleaf model) | >WENV170016296 Ser GGA c GCCA gattagattc G - C G - C T - A G - C A - T G - C G - C T A T C T C C C A C G A G | | | | | G G G C C T G A G G G C G | | | T T T A G G A T G A G TATACGAGAAATCGTATC C - G A - T C - G G + T C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |