Sequence ID | >WENV170016299 |
Genome ID | AZIJ01022285 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 931 |
End posion on genome | 1002 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
agcctaaaag |
tRNA gene sequence |
GGCATCGTGGCCGAGTGGCTAGGCTCAGCTCTGCAAAAGCTGCTACAGCGGTTCGAATCC |
Downstream region at tRNA end position |
aaaaccttca |
Secondary structure (Cloverleaf model) | >WENV170016299 Cys GCA g TCtt aaaaccttca G - C G - C C - G A - T T - A C - G G - C T A T T C G C C A G A G | | | | | G T G C C G A G C G G C G | | | T T G A G G C C T T CTAC C - G A - T G - C C - G T - A C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |